Home > Mutants (Isolated) > tm2403

Mutants (Isolated)

Allele Name		tm2403
Allele Type		Normal
Sequence Name		W08F4.8
Gene Name		cdc-37
Worm Base	Allele Name	tm2403
	Gene Name	cdc-37
	Sequence	W08F4.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		18266/18267-18726/18727 (460 bp deletion)
Chromosome		II
Putative gene structure		complement(join(17232..17354, 17995..18603, 18650..19030))
Map position		-15.59
Balancer
Map position of balancer
Sequence of primers		IntFwd:CACCCTTCAACGCCTCGATA,ExtFwd:TCTGGGCGACACCCTTCAAC,IntRev:GAGGACGACACTCACCCGAA,ExtRev:AGGATATCGAGGTTTCCGAC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Ezhil Buvani AP, Subramaniam K. The C. elegans gene gvd-1 promotes late larval development and germ cell proliferation. Biol Open 2023 12(7)   [ PubMed ID = 37310364 ] [ RRC reference ]