Mutants (Isolated)

tm2402

Allele Nametm2402
Sequence NameF43G6.9
CGC Namepatr-1
Worm BaseAllele Name tm2402
CGC Name patr-1
Sequence F43G6.9
Phenotypehomozygous viable
Mutation site[F44E5] 28377/28378-[F44E5] 28786/28787 (409 bp deletion)
ChromosomeII
Putative gene structurecomplement(join([F43G6] 544..604, 354..496, 141..302, [F44E5] 28801..28992, 28169..28753, 27838..28116, 27291..27790, 26906..27239, 26612..26857))
Map position4.04
Balancer
Map position of balancer
Sequence of primersIntRev:TCAGTACCTGCAGCTCCTAC,ExtRev:AACGGGACCGATGGAGCATA,IntFwd:CGTAGCTTTGGCCCACTCCA,ExtFwd:GCTGTCGCTAATGACGCTGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Boag PR, Atalay A, Robida S, Reinke V, Blackwell TK.
Protection of specific maternal messenger RNAs by the P body protein CGH-1 (Dhh1/RCK) during Caenorhabditis elegans oogenesis.
J. Cell Biol. 2008 182(3) 543-57 
[ PubMed ID = 18695045 ] [ RRC reference ]