Mutants (Isolated)

tm2401

Allele Nametm2401
Sequence NameF58G1.1
CGC NameF58G1.1
Worm BaseAllele Name tm2401
CGC Name F58G1.1
Sequence F58G1.1
Phenotypehomozygous viable
Mutation site10282/10283-10827/10828 (545 bp deletion)
ChromosomeII
Putative gene structurejoin(7992..8147, 8200..8390, 8436..8604, 8649..9054, 9101..9827, 9873..10048, 10095..10263, 10313..10487, 10531..10776, 10817..11181, 11230..11347)
Map position13.34
Balancer
Map position of balancer
Sequence of primersExtFwd:GCAACGAAAGCCAATTGCAC,IntFwd:TCACTACACTCCATCGTATG,ExtRev:TCATGCGTTGACACGACGAC,IntRev:GATCTCCGGACGCTTTGTAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Xu F, Feng X, Chen X, Weng C, Yan Q, Xu T, Hong M, Guang S.
A Cytoplasmic Argonaute Protein Promotes the Inheritance of RNAi.
Cell Rep 2018 23(8) 2482-2494 
[ PubMed ID = 29791857 ] [ RRC reference ]

Wan G, Fields BD, Spracklin G, Shukla A, Phillips CM, Kennedy S.
Spatiotemporal regulation of liquid-like condensates in epigenetic inheritance.
Nature 2018 557(7707) 679-683 
[ PubMed ID = 29769721 ] [ RRC reference ]