Mutants (Isolated)

tm2397

Allele Nametm2397
Sequence NameC18H9.8
CGC Nameift-74
Worm BaseAllele Name tm2397
CGC Name ift-74
Sequence C18H9.8
Phenotypehomozygous viable. Dr. S. Mitani: Genes to Cells 12, 593 (2007).
Mutation site3238/3239-3599/3600 (361 bp deletion)
ChromosomeII
Putative gene structurejoin(2396..2464, 2519..2595, 2649..2743, 2823..3004, 3163..3268, 3318..3604, 3659..4166, 4614..4859, 4912..5189, 5241..5351, 5400..5465)
Map position-0.04
Balancer
Map position of balancer
Sequence of primersExtFwd:CAGATGGGTGGACGCCCAAT,ExtRev:CCTTGTGAGTCATACTCGTG,IntFwd:AAGACCTCCAACAGCCGGAT,IntRev:CCATGCTTCTGGTGTTAGTG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kobayashi T, Gengyo-Ando K, Ishihara T, Katsura I, Mitani S.
IFT-81 and IFT-74 are required for intraflagellar transport in C. elegans.
Genes Cells 2007 12(5) 593-602 
[ PubMed ID = 17535250 ] [ RRC reference ]