| Allele Name | tm2394 |
| Sequence Name | C18H9.8 |
| CGC Name | ift-74 |
| Worm Base | Allele Name |
tm2394
|
| CGC Name |
ift-74
|
| Sequence |
C18H9.8
|
| Phenotype | homozygous viable. Dr. S. Mitani: Genes to Cells 12, 593 (2007). |
| Mutation site | 2746/2747-TTCCACTGTTTC-3062/3063 (316 bp deletion + 12 bp insertion) |
| Chromosome | II |
| Putative gene structure | join(2396..2464, 2519..2595, 2649..2743, 2823..3004, 3163..3268, 3318..3604, 3659..4166, 4614..4859, 4912..5189, 5241..5351, 5400..5465) |
| Map position | -0.04 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:AGCTGCTGGTGTAGGACATG,IntFwd:GCTGACAAACCAGAATGGTC,ExtRev:CAATCCGGCTGTTGGAGGTC,IntRev:AGTCATTGGGCGTCCACCCA |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Hao L, Thein M, Brust-Mascher I, Civelekoglu-Scholey G, Lu Y, Acar S, Prevo B, Shaham S, Scholey JM.
Intraflagellar transport delivers tubulin isotypes to sensory cilium middle and distal segments.
Nat Cell Biol 2011 13(7) 790-8
[ PubMed ID = 21642982 ]
[ RRC reference ]
|
Kobayashi T, Gengyo-Ando K, Ishihara T, Katsura I, Mitani S.
IFT-81 and IFT-74 are required for intraflagellar transport in C. elegans.
Genes Cells 2007 12(5) 593-602
[ PubMed ID = 17535250 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.