Mutants (Isolated)

tm2393

Allele Nametm2393
Allele TypeNormal
Sequence NameC18H9.8
Gene Nameift-74
Worm BaseAllele Name tm2393
Gene Name ift-74
Sequence C18H9.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. P. Sengupta: partially Dyf. Dr. S. Mitani: Genes to Cells 12, 593 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 2485/2486-3021/3022 (536 bp deletion)
ChromosomeII
Putative gene structurejoin(2396..2464, 2519..2595, 2649..2743, 2823..3004, 3163..3268, 3318..3604, 3659..4166, 4614..4859, 4912..5189, 5241..5351, 5400..5465)
Map position-0.04
Balancer
Map position of balancer
Sequence of primersExtRev:CAATCCGGCTGTTGGAGGTC,IntFwd:GCTGACAAACCAGAATGGTC,IntRev:AGTCATTGGGCGTCCACCCA,ExtFwd:AGCTGCTGGTGTAGGACATG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Maurya AK, Rogers T, Sengupta P.
A CCRK and a MAK Kinase Modulate Cilia Branching and Length via Regulation of Axonemal Microtubule Dynamics in Caenorhabditis elegans.
Curr Biol 2019 29(8) 1286-1300.e4 
[ PubMed ID = 30955935 ] [ RRC reference ]