Mutants (Isolated)

tm2391

Allele Nametm2391
Sequence NameF46A9.5
CGC Nameskr-1
Worm BaseAllele Name tm2391
CGC Name skr-1
Sequence F46A9.5
Phenotypelethal or sterile
Mutation site[F46A9]29584/29585-[F30A10]257/258 (435 bp deletion)
ChromosomeI
Putative gene structurejoin([F46A9] 29447..29527, 29712..29867, [F30A10] 106..225, 271..444)
Map position3.77
Balancer
Map position of balancer
Sequence of primersExtFwd:CGCATCATACGACACACTCA,IntFwd:ATCCGAGGCGGCAAAGGAAC,ExtRev:AGGACAATGTGTGAAGTGTG,IntRev:GGGTAATTTAATCCTCGCAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Killian DJ, Harvey E, Johnson P, Otori M, Mitani S, Xue D.
SKR-1, a homolog of Skp1 and a member of the SCF(SEL-10) complex, regulates sex-determination and LIN-12/Notch signaling in C. elegans.
Dev. Biol. 2008 322(2) 322-31 
[ PubMed ID = 18718460 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]