Home > Mutants (Isolated) > tm2391

Mutants (Isolated)

Allele Name		tm2391
Allele Type		Balanced
Sequence Name		F46A9.5
Gene Name		skr-1
Worm Base	Allele Name	tm2391
	Gene Name	skr-1
	Sequence	F46A9.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		[F46A9]29584/29585-[F30A10]257/258 (435 bp deletion)
Chromosome		I
Putative gene structure		join([F46A9] 29447..29527, 29712..29867, [F30A10] 106..225, 271..444)
Map position		3.77
Balancer		unc-3 (e151) X
Map position of balancer
Sequence of primers		IntFwd:ATCCGAGGCGGCAAAGGAAC,ExtFwd:CGCATCATACGACACACTCA,IntRev:GGGTAATTTAATCCTCGCAC,ExtRev:AGGACAATGTGTGAAGTGTG
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Wu CW, Deonarine A, Przybysz A, Strange K, Choe KP. The Skp1 Homologs SKR-1/2 Are Required for the Caenorhabditis elegans SKN-1 Antioxidant/Detoxification Response Independently of p38 MAPK. PLoS Genet 2016 12(10) e1006361  [ PubMed ID = 27776126 ] [ RRC reference ] C. elegans Deletion Mutant Consortium. large-scale screening for targeted knockouts in the Caenorhabditis elegans genome. G3 (Bethesda) 2012 2(11) 1415-25  [ PubMed ID = 23173093 ] [ RRC reference ] Killian DJ, Harvey E, Johnson P, Otori M, Mitani S, Xue D. SKR-1, a homolog of Skp1 and a member of the SCF(SEL-10) complex, regulates sex-determination and LIN-12/Notch signaling in C. elegans. Dev Biol 2008 322(2) 322-31  [ PubMed ID = 18718460 ] [ RRC reference ]