Mutants (Isolated)

tm2389

Allele Nametm2389
Sequence NameF32A6.1
CGC Nameift-81
Worm BaseAllele Name tm2389
CGC Name ift-81
Sequence F32A6.1
Phenotypehomozygous viable
Mutation site20079/20080-20976/20977 (897 bp deletion)
ChromosomeX
Putative gene structurejoin(19980..20069, 20117..20203, 20530..20655, 20865..21032)
Map position-5.73
Balancer
Map position of balancer
Sequence of primersExtFwd:CAACGAAATACGATCGTCCG ,ExtRev:CCTTGGTCACAATGGACAAG ,IntFwd:AGAGGTAAGATAGGGGGGTT,IntRev:GTGTGGAAGGTTTCGTTTAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kobayashi T, Gengyo-Ando K, Ishihara T, Katsura I, Mitani S.
IFT-81 and IFT-74 are required for intraflagellar transport in C. elegans.
Genes Cells 2007 12(5) 593-602 
[ PubMed ID = 17535250 ] [ RRC reference ]