Mutants (Isolated)

tm2388

Allele Nametm2388
Sequence NameY57G11C.13
CGC Namearl-8
Worm BaseAllele Name tm2388
CGC Name arl-8
Sequence Y57G11C.13
Phenotypehomozygous viable.
Mutation site161589/161590-161962/161963 (373 bp deletion)
ChromosomeIV
Putative gene structurejoin(160907..161029, 161078..161465, 161513..161559)
Map position12.52
Balancer
Map position of balancer
Sequence of primersIntRev:ATTAGGCTGCAATGCTAGAG,ExtRev:GCAACAGTTCCCGAATCGCT,ExtFwd:CGCTATTCCAGTTTTGGTGC,IntFwd:CAAGAAGGATTTGCCTGGAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Klassen MP, Wu YE, Maeder CI, Nakae I, Cueva JG, Lehrman EK, Tada M, Gengyo-Ando K, Wang GJ, Goodman M, Mitani S, Kontani K, Katada T, Shen K.
An Arf-like small G protein, ARL-8, promotes the axonal transport of presynaptic cargoes by suppressing vesicle aggregation.
Neuron 2010 66(5) 710-23 
[ PubMed ID = 20547129 ] [ RRC reference ]

Fischer SE, Pan Q, Breen PC, Qi Y, Shi Z, Zhang C, Ruvkun G.
Multiple small RNA pathways regulate the silencing of repeated and foreign genes in C. elegans.
Genes Dev. 2013 27(24) 2678-95 
[ PubMed ID = 24352423 ] [ RRC reference ]

Wu YE, Huo L, Maeder CI, Feng W, Shen K.
The balance between capture and dissociation of presynaptic proteins controls the spatial distribution of synapses.
Neuron 2013 78(6) 994-1011 
[ PubMed ID = 23727120 ] [ RRC reference ]

Li Y, Zhang Y, Gan Q, Xu M, Ding X, Tang G, Liang J, Liu K, Liu X, Wang X, Guo L, Gao Z, Hao X, Yang C.
C. elegans-based screen identifies lysosome-damaging alkaloids that induce STAT3-dependent lysosomal cell death.
Protein Cell 2018 9(12) 1013-1026 
[ PubMed ID = 29611115 ] [ RRC reference ]

Niwa S, Tao L, Lu SY, Liew GM, Feng W, Nachury MV, Shen K.
BORC Regulates the Axonal Transport of Synaptic Vesicle Precursors by Activating ARL-8.
Curr. Biol. 2017 27(17) 2569-2578.e4 
[ PubMed ID = 28823680 ] [ RRC reference ]