Mutants (Isolated)

tm2386

Allele Nametm2386
Sequence NameW02H5.7
CGC Namesknr-1
Worm BaseAllele Name tm2386
CGC Name sknr-1
Sequence W02H5.7
Phenotypehomozygous viable
Mutation site5460/5461-CA-5688/5689 (228 bp deletion + 2 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(3690..3748, 3803..4050, 4108..4317, 5052..5298, 5637..5777, 5824..6097, 6906..7094))
Map position-13.42
Balancer
Map position of balancer
Sequence of primersExtFwd:ATCCCTGATGGGTACCCACT,IntFwd:AGCTATCGGGATACCAAGAG,ExtRev:TTGGGTTCAGGAAGGGCAAT,IntRev:CGGCATTGTCGGTTGCCGAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Ruf V, Holzem C, Peyman T, Walz G, Blackwell TK, Neumann-Haefelin E.
TORC2 signaling antagonizes SKN-1 to induce C. elegans mesendodermal embryonic development.
Dev. Biol. 2013 384(2) 214-27 
[ PubMed ID = 23973804 ] [ RRC reference ]