Mutants (Isolated)

tm2385

Allele Nametm2385
Sequence NameF39C12.4
CGC Namentc-1
Worm BaseAllele Name tm2385
CGC Name ntc-1
Sequence F39C12.4
Phenotypehomozygous viable. Dr. C. Bargmann: viable, fertile.
Mutation site31393/31394-31610/31611 (217 bp deletion)
ChromosomeX
Putative gene structurejoin(31316..31433, 31490..31602, 31651..31702, 31753..31781)
Map position-6.22
Balancer
Map position of balancer
Sequence of primersExtRev:TCTAGCCATCGCTTTACACT,IntFwd:CGCGCGGATTTCAGTCGTAA,ExtFwd:GACGCGTGAGTCGACTTATC,IntRev:GCTTGCTTGATCCGTTTAAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Garrison JL, Macosko EZ, Bernstein S, Pokala N, Albrecht DR, Bargmann CI.
Oxytocin/vasopressin-related peptides have an ancient role in reproductive behavior.
Science 2012 338(6106) 540-3 
[ PubMed ID = 23112335 ] [ RRC reference ]

Scott E, Hudson A, Feist E, Calahorro F, Dillon J, de Freitas R, Wand M, Schoofs L, O'Connor V, Holden-Dye L.
An oxytocin-dependent social interaction between larvae and adult C. elegans.
Sci Rep 2017 7(1) 10122 
[ PubMed ID = 28860630 ] [ RRC reference ]