Mutants (Isolated)

tm2371

Allele Nametm2371
Sequence NameC34D4.14
CGC Namehecd-1
Worm BaseAllele Name tm2371
CGC Name hecd-1
Sequence C34D4.14
Phenotypehomozygous viable. Dr. A. Dernburg: No defects in growth, fertility or meiotic chromosome behavior.
Mutation site25747/25748-26737/26738 (990 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(20024..20131, 20187..20260, 20307..20574, 20629..20773, 20820..21242, 21300..21730, 21780..22723, 22806..23669, 23851..24187, 24255..24422, 24478..25920, 25968..26228, 26279..26392, 26508..26645, 26823..27206, 27285..27943, 27989..28179, 28238..28476, 28522..29013, 29083..29327, 29374..29731))
Map position3.29
Balancer
Map position of balancer
Sequence of primersIntFwd:TACCGAATGGTTGGCGAGTA,ExtFwd:TCTTCCATATCCACGCGAGT,IntRev:GCCAGGGAACACCTTATCGT,ExtRev:GACAGTATTGAGCCAGGGAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Segref A, Kevei É, Pokrzywa W, Schmeisser K, Mansfeld J, Livnat-Levanon N, Ensenauer R, Glickman MH, Ristow M, Hoppe T.
Pathogenesis of human mitochondrial diseases is modulated by reduced activity of the ubiquitin/proteasome system.
Cell Metab. 2014 19(4) 642-52 
[ PubMed ID = 24703696 ] [ RRC reference ]