Home > Mutants (Isolated) > tm2371

Mutants (Isolated)

Allele Name		tm2371
Sequence Name		C34D4.14
CGC Name		hecd-1
Worm Base	Allele Name	tm2371
	CGC Name	hecd-1
	Sequence	C34D4.14
Phenotype		homozygous viable. Dr. A. Dernburg: No defects in growth, fertility or meiotic chromosome behavior.
Mutation site		25747/25748-26737/26738 (990 bp deletion)
Chromosome		IV
Putative gene structure		complement(join(20024..20131, 20187..20260, 20307..20574, 20629..20773, 20820..21242, 21300..21730, 21780..22723, 22806..23669, 23851..24187, 24255..24422, 24478..25920, 25968..26228, 26279..26392, 26508..26645, 26823..27206, 27285..27943, 27989..28179, 28238..28476, 28522..29013, 29083..29327, 29374..29731))
Map position		3.29
Balancer
Map position of balancer
Sequence of primers		IntFwd:TACCGAATGGTTGGCGAGTA,ExtFwd:TCTTCCATATCCACGCGAGT,IntRev:GCCAGGGAACACCTTATCGT,ExtRev:GACAGTATTGAGCCAGGGAA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Segref A, Kevei É, Pokrzywa W, Schmeisser K, Mansfeld J, Livnat-Levanon N, Ensenauer R, Glickman MH, Ristow M, Hoppe T. Pathogenesis of human mitochondrial diseases is modulated by reduced activity of the ubiquitin/proteasome system. Cell Metab. 2014 19(4) 642-52  [ PubMed ID = 24703696 ] [ RRC reference ]