Mutants (Isolated)

tm2367

Allele Nametm2367
Sequence NameY97E10AR.7
CGC NameY97E10AR.7
Worm BaseAllele Name tm2367
CGC Name Y97E10AR.7
Sequence Y97E10AR.7
Phenotypehomozygous viable.
Mutation site15201/15202-TTTT-15438/15439 (237 bp deletion + 4 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(15158..15348, 15457..15640))
Map position1
Balancer
Map position of balancer
Sequence of primersExtRev:GTTCCCTACCTGTTCCAATA,IntRev:CGCTGGTTGATGTTCTCGGA,ExtFwd:GGGATGAATGAGACCCGATA,IntFwd:TCGATCATCCCAAATCGTGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chen J, Ou Y, Li Y, Hu S, Shao LW, Liu Y.
Metformin extends C. elegans lifespan through lysosomal pathway.
Elife 2017 6  
[ PubMed ID = 29027899 ] [ RRC reference ]