Mutants (Isolated)

tm2366

Allele Nametm2366
Sequence NameW06H3.1
CGC Nameimmt-2
Worm BaseAllele Name tm2366
CGC Name immt-2
Sequence W06H3.1
Phenotypehomozygous viable. Dr. A. van der Bliek: fertile, Sma (~20%), Gro, normal locomotion. Connected mitochondria in muscle.
Mutation site2406/2407-TC-3007/3008 (601 bp deletion + 2 bp insertion)
ChromosomeV
Putative gene structurejoin(2395..2418, 2465..2602, 2652..3527, 4280..4546, 4605..4699, 5061..5423, 5473..5701)
Map position11.17
Balancer
Map position of balancer
Sequence of primersExtFwd:CGTGACCGTGTACACGAAAG,IntFwd:CACGAAAGTACGTGACACGT,ExtRev:GCATGAGCCAAAATCGTGTG,IntRev:CCGCTACACGATCACTGTAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mun JY, Lee TH, Kim JH, Yoo BH, Bahk YY, Koo HS, Han SS.
Caenorhabditis elegans mitofilin homologs control the morphology of mitochondrial cristae and influence reproduction and physiology.
J. Cell. Physiol. 2010 224(3) 748-56 
[ PubMed ID = 20578245 ] [ RRC reference ]

Head BP, Zulaika M, Ryazantsev S, van der Bliek AM.
A novel mitochondrial outer membrane protein, MOMA-1, that affects cristae morphology in Caenorhabditis elegans.
Mol. Biol. Cell 2011 22(6) 831-41 
[ PubMed ID = 21248201 ] [ RRC reference ]