Mutants (Isolated)

tm2364

Allele Nametm2364
Sequence NameT03D8.5
CGC Namegcy-22
Worm BaseAllele Name tm2364
CGC Name gcy-22
Sequence T03D8.5
Phenotypehomozygous viable. Dr. O. Hobert: broad ASE-mediated chemotaxis defective.
Mutation site6535/6536-6836/6837 (301 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(4568..4645, 4690..4784, 4838..5111, 5331..5523, 5569..5642, 5690..6145, 6203..6463, 6509..6770, 6818..7017, 7123..7280, 7329..7469, 7515..7685, 7730..7852, 8034..8128, 8180..8312, 8357..8463, 8974..9191))
Map position25.28
Balancer
Map position of balancer
Sequence of primersIntFwd:GGAGTGCATCTTGAGGCTAA,ExtFwd:TTGCCGCCCACCTCAGATAC,IntRev:GATCCGGTAGCCTCAAGCGT,ExtRev:AGCACTCGTACCCCACTATT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kunitomo H, Iino Y.
Caenorhabditis elegans che-5 is allelic to gcy-22.
MicroPubl Biol 2020 2020  
[ PubMed ID = 33313485 ] [ RRC reference ]

Woldemariam S, Nagpal J, Hill T, Li J, Schneider MW, Shankar R, Futey M, Varshney A, Ali N, Mitchell J, Andersen K, Barsi-Rhyne B, Tran A, Costa WS, Krzyzanowski MC, Yu YV, Brueggemann C, Hamilton OS, Ferkey DM, VanHoven M, Sengupta P, Gottschalk A, L'Etoile N.
Using a Robust and Sensitive GFP-Based cGMP Sensor for Real-Time Imaging in Intact Caenorhabditis elegans.
Genetics 2019 213(1) 59-77 
[ PubMed ID = 31331946 ] [ RRC reference ]

Horspool AM, Chang HC.
Neuron-specific regulation of superoxide dismutase amid pathogen-induced gut dysbiosis.
Redox Biol 2018 17 377-385 
[ PubMed ID = 29857312 ] [ RRC reference ]

Hallem EA, Spencer WC, McWhirter RD, Zeller G, Henz SR, Rätsch G, Miller DM 3rd, Horvitz HR, Sternberg PW, Ringstad N.
Receptor-type guanylate cyclase is required for carbon dioxide sensation by Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2011 108(1) 254-9 
[ PubMed ID = 21173231 ] [ RRC reference ]

Mok CA, Healey MP, Shekhar T, Leroux MR, Héon E, Zhen M.
Mutations in a guanylate cyclase GCY-35/GCY-36 modify Bardet-Biedl syndrome-associated phenotypes in Caenorhabditis elegans.
PLoS Genet 2011 7(10) e1002335 
[ PubMed ID = 22022287 ] [ RRC reference ]

Smith HK, Luo L, O'Halloran D, Guo D, Huang XY, Samuel AD, Hobert O.
Defining specificity determinants of cGMP mediated gustatory sensory transduction in Caenorhabditis elegans.
Genetics 2013 194(4) 885-901 
[ PubMed ID = 23695300 ] [ RRC reference ]

Murayama T, Takayama J, Fujiwara M, Maruyama IN.
Environmental alkalinity sensing mediated by the transmembrane guanylyl cyclase GCY-14 in C. elegans.
Curr Biol 2013 23(11) 1007-12 
[ PubMed ID = 23664973 ] [ RRC reference ]

Kunitomo H, Sato H, Iwata R, Satoh Y, Ohno H, Yamada K, Iino Y.
Concentration memory-dependent synaptic plasticity of a taste circuit regulates salt concentration chemotaxis in Caenorhabditis elegans.
Nat Commun 2013 4 2210 
[ PubMed ID = 23887678 ] [ RRC reference ]

Ortiz CO, Faumont S, Takayama J, Ahmed HK, Goldsmith AD, Pocock R, McCormick KE, Kunimoto H, Iino Y, Lockery S, Hobert O.
Lateralized gustatory behavior of C. elegans is controlled by specific receptor-type guanylyl cyclases.
Curr Biol 2009 19(12) 996-1004 
[ PubMed ID = 19523832 ] [ RRC reference ]