Home > Mutants (Isolated) > tm2363

Mutants (Isolated)

Allele Name		tm2363
Allele Type		Normal
Sequence Name		C46H11.11
Gene Name		fhod-1
Worm Base	Allele Name	tm2363
	Gene Name	fhod-1
	Sequence	C46H11.11
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		40271/40272-CNANCCTCAC-40648/40649 (377 bp deletion + 10 bp insertion)
Chromosome		I
Putative gene structure		complement(join(38868..38923, 39048..39167, 39213..39677, 39729..40434, 40486..40775, 41022..41358, 41405..41533, 41616..41742, 41858..41945, 43617..43851, 44442..44642, 44856..44923, 45478..45536, 48449..48623, 48944..49076))
Map position		-0.42
Balancer
Map position of balancer
Sequence of primers		ExtFwd:TGGCCAAAAGCATTCCCATC,IntFwd:TGCATATCCATAAGGGGCTC,ExtRev:CAATCCCAGTGGGCTGCCAT,IntRev:CAGTGATATTGGAGCCGCTC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Lardennois A, Pásti G, Ferraro T, Llense F, Mahou P, Pontabry J, Rodriguez D, Kim S, Ono S, Beaurepaire E, Gally C, Labouesse M. An actin-based viscoplastic lock ensures progressive body-axis elongation. Nature 2019 573(7773) 266-270  [ PubMed ID = 31462781 ] [ RRC reference ] Refai O, Smit RB, Votra S, Pruyne D, Mains PE. Tissue-Specific Functions of fem-2/PP2c Phosphatase and fhod-1/formin During Caenorhabditis elegans Embryonic Morphogenesis. G3 (Bethesda) 2018 8(7) 2277-2290  [ PubMed ID = 29720391 ] [ RRC reference ] Hegsted A, Wright FA, Votra S, Pruyne D. INF2- and FHOD-related formins promote ovulation in the somatic gonad of C. elegans. Cytoskeleton (Hoboken) 2016 73(12) 712-728  [ PubMed ID = 27770600 ] [ RRC reference ] Mi-Mi L, Votra S, Kemphues K, Bretscher A, Pruyne D. Z-line formins promote contractile lattice growth and maintenance in striated muscles of C. elegans. J Cell Biol 2012 198(1) 87-102  [ PubMed ID = 22753896 ] [ RRC reference ] Vanneste CA, Pruyne D, Mains PE. The role of the formin gene fhod-1 in C. elegans embryonic morphogenesis. Worm 2013 2(3) e25040  [ PubMed ID = 24778933 ] [ RRC reference ] Mi-Mi L, Pruyne D. Loss of Sarcomere-associated Formins Disrupts Z-line Organization, but does not Prevent Thin Filament Assembly in Caenorhabditis elegans Muscle. J Cytol Histol 2015 6(2)   [ PubMed ID = 26161293 ] [ RRC reference ]