Mutants (Isolated)

tm2360

Allele Nametm2360
Sequence NameC50C3.8
CGC Namebath-42
Worm BaseAllele Name tm2360
CGC Name bath-42
Sequence C50C3.8
Phenotypehomozygous viable. Dr. M. Treinin: number of eggs laid by levamisole is reduced.
Mutation site4001/4002-4412/4413 (411 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(3679..4016, 4141..4705, 4756..5024, 5079..5139))
Map position-0.37
Balancer
Map position of balancer
Sequence of primersExtFwd:CAGACTGATCCAATCCTGTG,ExtRev:CCTCGCCGTCTAGAAGTAGT,IntFwd:CACACGGTGATGTGTCGTCA,IntRev:CGTGTGACGGCACTTTCTAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Shteingauz A, Cohen E, Biala Y, Treinin M.
The BTB-MATH protein BATH-42 interacts with RIC-3 to regulate maturation of nicotinic acetylcholine receptors.
J. Cell. Sci. 2009 122(Pt 6) 807-12 
[ PubMed ID = 19223395 ] [ RRC reference ]

Bae YK, Kim E, L'hernault SW, Barr MM.
The CIL-1 PI 5-phosphatase localizes TRP Polycystins to cilia and activates sperm in C. elegans.
Curr. Biol. 2009 19(19) 1599-607 
[ PubMed ID = 19781942 ] [ RRC reference ]