Mutants (Isolated)

tm2359

Allele Nametm2359
Sequence NameY48C3A.17
CGC Nameefl-2
Worm BaseAllele Name tm2359
CGC Name efl-2
Sequence Y48C3A.17
Phenotypehomozygous viable. Dr. J. Kaplan: non-Egl, non-Unc.
Mutation site150519/150520-TTTCCAAATTTTTGGATGTNNCGNCCCCTTTGNGAAAATTTTTCTTT-150849/150850 (330 bp deletion + 47 bp insertion)
ChromosomeII
Putative gene structurejoin(150626..150918, 152479..152628, 153489..153582, 153776..154058, 154574..154735, 155490..155746)
Map position16.82
Balancer
Map position of balancer
Sequence of primersIntFwd:GCGTGGCTTATTGCACACTG,ExtFwd:ATGGGCGTGGCTTATTGCAC,IntRev:CTCCACATAACCGAGCCCCT,ExtRev:ATCGCACTAACATCCATCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Schertel C, Conradt B.
C. elegans orthologs of components of the RB tumor suppressor complex have distinct pro-apoptotic functions.
Development 2007 134(20) 3691-701 
[ PubMed ID = 17881492 ] [ RRC reference ]