Mutants (Isolated)

tm2356

Allele Nametm2356
Sequence NameF32A6.2
CGC Nameift-81
Worm BaseAllele Name tm2356
CGC Name ift-81
Sequence F32A6.2
Phenotypehomozygous viable. Dr. P. Sengupta: dye filling normal.
Mutation site14665/14666-14910/14911 (245 bp deletion)
ChromosomeX
Putative gene structurejoin(13454..13584, 14178..14297, 14355..14478, 14751..14831, 14919..15073, 15838..15922, 16160..16378)
Map position-5.73
Balancer
Map position of balancer
Sequence of primersExtFwd:GGGTATCAGCAGGTCCACTT,ExtRev:CTGAGCTCATTTGCCGGGCT,IntFwd:AGGTCCACTTGGGTAGAATG,IntRev:GCAAGAGTACGTCTGCCATT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kobayashi T, Gengyo-Ando K, Ishihara T, Katsura I, Mitani S.
IFT-81 and IFT-74 are required for intraflagellar transport in C. elegans.
Genes Cells 2007 12(5) 593-602 
[ PubMed ID = 17535250 ] [ RRC reference ]