Mutants (Isolated)

tm2351

Allele Nametm2351
Sequence NameF55A4.4
CGC NameF55A4.4
Worm BaseAllele Name tm2351
CGC Name F55A4.4
Sequence F55A4.4
Phenotypehomozygous viable
Mutation site20747/20748-GGAGATAAG-21348/21349 (601 bp deletion + 9 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(20484..20688, 20916..21213, 21601..21898, 22222..22230))
Map position-18.83
Balancer
Map position of balancer
Sequence of primersIntRev:GAGCCCACTGCTCAACGAGA,IntFwd:ACCATGTGTTTGGTCCTACA,ExtRev:CCCTCACAGTATTGAGCCCA,ExtFwd:CGGGCTTGCTGTAAGTTGCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Amano H, Maruyama IN.
Aversive olfactory learning and associative long-term memory in Caenorhabditis elegans.
Learn. Mem. 2011 18(10) 654-65 
[ PubMed ID = 21960709 ] [ RRC reference ]