Mutants (Isolated)

tm2344

Allele Nametm2344
Sequence NameC33H5.15
CGC Namesgo-1
Worm BaseAllele Name tm2344
CGC Name sgo-1
Sequence C33H5.15
Phenotypehomozygous viable. DR. B.J. Meyer: no obvious embryonic lethality or Him phenotypes. Dr. M. Colaiacovo: Genes & Dev, 22, 2869 (2008)
Mutation site21828/21829-22038/22039 (210 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(21369..21491, 21585..21775, 21830..22009, 22061..22284, 22339..22406, 22462..22529, 22577..22646))
Map position3.48
Balancer
Map position of balancer
Sequence of primersExtFwd:AGGGCGGGAGTTGATGGCTT,ExtRev:GGTGTGTGGTCCGTGGTCAT,IntFwd:CCTAGCCGTTGGCTTAGAAG,IntRev:GAGCGCCAACGATTCTCTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
de Carvalho CE, Zaaijer S, Smolikov S, Gu Y, Schumacher JM, Colaiácovo MP.
LAB-1 antagonizes the Aurora B kinase in C. elegans.
Genes Dev. 2008 22(20) 2869-85 
[ PubMed ID = 18923084 ] [ RRC reference ]