Mutants (Isolated)

tm2341

Allele Nametm2341
Sequence NameF53G12.1
CGC Namerab-11.1
Worm BaseAllele Name tm2341
CGC Name rab-11.1
Sequence F53G12.1
Phenotypelethal or sterile. Dr. C. Rongo: unable to examine GLR-1 trafficking.
Mutation site1793/1794-2636/2637 (843 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(1585..1766, 1812..2103, 2155..2276, 2325..2364))
Map position-19.84
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersIntFwd:AGGGTTTCTCGGTATCGAGT,ExtFwd:GTTGCTTTCTTGGCGAGGGT,IntRev:TAGCGTCGCGTACCCTCAGA,ExtRev:CTGCGAAAGGGGTACGGTAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sato M, Grant BD, Harada A, Sato K.
Rab11 is required for synchronous secretion of chondroitin proteoglycans after fertilization in Caenorhabditis elegans.
J. Cell. Sci. 2008 121(Pt 19) 3177-86 
[ PubMed ID = 18765566 ] [ RRC reference ]

Zheng C, Diaz-Cuadros M, Chalfie M.
Hox Genes Promote Neuronal Subtype Diversification through Posterior Induction in Caenorhabditis elegans.
Neuron 2015 88(3) 514-27 
[ PubMed ID = 26539892 ] [ RRC reference ]