Mutants (Isolated)

tm2339

Allele Nametm2339
Sequence NameC06H2.6
CGC NameC06H2.6
Worm BaseAllele Name tm2339
CGC Name C06H2.6
Sequence C06H2.6
PhenotypeGro
Mutation site2797/2798-3133/3134 (336 bp deletion)
ChromosomeV
Putative gene structurejoin(2793..2892, 2957..3049, 3097..3341)
Map position2.95
Balancer
Map position of balancer
Sequence of primersIntFwd:TCGGCCCTCGGGACAAAACT,ExtFwd:AGTCTATCGCCCGTGAAAAC,IntRev:TGCAGAAGGGTACGATGGTG,ExtRev:GGCATGAACTTGAAAAGCTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chen J, Ou Y, Li Y, Hu S, Shao LW, Liu Y.
Metformin extends C. elegans lifespan through lysosomal pathway.
Elife 2017 6  
[ PubMed ID = 29027899 ] [ RRC reference ]