Mutants (Isolated)

tm2337

Allele Nametm2337
Sequence NameT03F6.1
CGC Nameqdpr-1
Worm BaseAllele Name tm2337
CGC Name qdpr-1
Sequence T03F6.1
Phenotypehomozygous viable
Mutation site32059/32060-32372/32373 (313 bp deletion)
ChromosomeIII
Putative gene structurejoin(31830..31913, 31972..32075, 32133..32256, 32309..32577, 32632..32761)
Map position21.21
Balancer
Map position of balancer
Sequence of primersExtFwd:AGTTATCGTATACGGAGGCA,IntFwd:TACGGAGGCAAAGGCGCACT,ExtRev:TTTGAGGAGAGCCCCGGAAG,IntRev:CGGAAGATGGACGGCTCGAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Loer CM, Calvo AC, Watschinger K, Werner-Felmayer G, O'Rourke D, Stroud D, Tong A, Gotenstein JR, Chisholm AD, Hodgkin J, Werner ER, Martinez A.
Cuticle integrity and biogenic amine synthesis in Caenorhabditis elegans require the cofactor tetrahydrobiopterin (BH4).
Genetics 2015 200(1) 237-53 
[ PubMed ID = 25808955 ] [ RRC reference ]