Mutants (Isolated)

tm2336

Allele Nametm2336
Sequence NameM176.3
CGC Namechch-3
Worm BaseAllele Name tm2336
CGC Name chch-3
Sequence M176.3
Phenotypehomozygous viable
Mutation site7123/7124-7397/7398 (274 bp deletion)
ChromosomeII
Putative gene structurejoin(6928..7010, 7074..7239, 7289..7432, 7481..7543, 7978..8031)
Map position1.41
Balancer
Map position of balancer
Sequence of primersIntFwd:CCCGAGGAGTACAAGTGAGT,ExtFwd:GACCGAAATGAGATTCCCGA,IntRev:CTCAGTAAGTGGAGCACACT,ExtRev:ACCTCAGTAAGTGGAGCACA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Head BP, Zulaika M, Ryazantsev S, van der Bliek AM.
A novel mitochondrial outer membrane protein, MOMA-1, that affects cristae morphology in Caenorhabditis elegans.
Mol. Biol. Cell 2011 22(6) 831-41 
[ PubMed ID = 21248201 ] [ RRC reference ]