Mutants (Isolated)

tm2334

Allele Nametm2334
Sequence NameY43H11AL.3
CGC Namepqn-85
Worm BaseAllele Name tm2334
CGC Name pqn-85
Sequence Y43H11AL.3
Phenotypelethal or sterile
Mutation site28719/28720-29234/29235 (515 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(19013..19156, 19730..19898, 19948..20216, 20266..20477, 21135..21393, 21579..21904, 22955..23209, 23263..23479, 23730..24050, 24493..24662, 24749..24980, 25328..25429, 25478..25693, 25779..25970, 26021..26413, 27433..27723, 27770..27984, 28612..28948, 29340..29748, 29820..30126, 30225..30682, 31112..31268, 31574..31775, 32191..32514, 32599..32829, 32878..33081))
Map position-15.72
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersIntRev:CCGTCCTGACGACAAAGAGA,IntFwd:GAGACGAGTCAATCCAACAC,ExtRev:ATGGACAAGCTCCGTCCTGA,ExtFwd:ATCCGACGCTGGGTAGATTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lightfoot J, Testori S, Barroso C, Martinez-Perez E.
Loading of meiotic cohesin by SCC-2 is required for early processing of DSBs and for the DNA damage checkpoint.
Curr. Biol. 2011 21(17) 1421-30 
[ PubMed ID = 21856158 ] [ RRC reference ]