Mutants (Isolated)

tm2318

Allele Nametm2318
Sequence NameC12C8.1
CGC Namehsp-70
Worm BaseAllele Name tm2318
CGC Name hsp-70
Sequence C12C8.1
Phenotypehomozygous viable
Mutation site1846/1847-2047/2048 (201 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(769..1626, 1688..2686, 2764..2838))
Map position3.74
Balancer
Map position of balancer
Sequence of primersIntRev:CCGCTCGTAATCCGGAGAAT,ExtRev:AAGACTACGCCTTCCTACGT,ExtFwd:CCATGACTTAGTGGGACAAC,IntFwd:GTACAGCTGCTTGAACGGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kourtis N, Nikoletopoulou V, Tavernarakis N.
Small heat-shock proteins protect from heat-stroke-associated neurodegeneration.
Nature 2012 490(7419) 213-8 
[ PubMed ID = 22972192 ] [ RRC reference ]

Erkut C, Vasilj A, Boland S, Habermann B, Shevchenko A, Kurzchalia TV.
Molecular strategies of the Caenorhabditis elegans dauer larva to survive extreme desiccation.
PLoS ONE 2013 8(12) e82473 
[ PubMed ID = 24324795 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]