Home > Mutants (Isolated) > tm2315

Mutants (Isolated)

Allele Name		tm2315
Allele Type		Balanced
Sequence Name		F52F12.6
Gene Name		ztf-11
Worm Base	Allele Name	tm2315
	Gene Name	ztf-11
	Sequence	F52F12.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		16903/16904-17134/17135 (231 bp deletion)
Chromosome		I
Putative gene structure		complement(join(16008..16355, 16711..16789, 16840..17134, 17344..17463, 17732..17945, 18758..18982, 19220..19377, 21959..22139))
Map position		4.06
Balancer		,hT2
Map position of balancer
Sequence of primers		ExtRev:GAGCGGTACTAAGTCCCAAC,ExtFwd:CCTTGATGGAATGAGTCCTG,IntRev:AAGGCAAACTGGCTTGTCCA,IntFwd:CCTGCTTGTGCTGCAGCCAA
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Lee J, Taylor CA, Barnes KM, Shen A, Stewart EV, Chen A, Xiang YK, Bao Z, Shen K. A Myt1 family transcription factor defines neuronal fate by repressing non-neuronal genes. Elife 2019 8   [ PubMed ID = 31386623 ] [ RRC reference ]