Mutants (Isolated)

tm2313

Allele Nametm2313
Sequence NameY17G7B.15
CGC Namecnt-1
Worm BaseAllele Name tm2313
CGC Name cnt-1
Sequence Y17G7B.15
Phenotypehomozygous viable. Dr. K. Ashrai: normal fat content observed by Nile-Red staining. Dr. G. Hermann: wild-type gut granules. Dr. K. Matsumoto: SNB-1::GFP was not mislocalized in sensory neurons. Dr. H. Sawa: non-Psa.
Mutation site106366/106367-T-106710/106711 (344 bp deletion + 1 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(103510..103666, 103888..103998, 104841..105186, 106260..106841, 108452..108821, 110048..110179, 115377..115547, 117739..117828, 118711..118849, 119504..119680, 119819..119952, 119998..120069))
Map position6.46
Balancer
Map position of balancer
Sequence of primersExtFwd:CCTCACCAGACCACGGATCA,ExtRev:TCCACGACCGCATTCGAACA,IntFwd:CCACGGATCAGCATCTAATA,IntRev:GTCCCAGGCAACGAAGTTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Shi A, Liu O, Koenig S, Banerjee R, Chen CC, Eimer S, Grant BD.
RAB-10-GTPase-mediated regulation of endosomal phosphatidylinositol-4,5-bisphosphate.
Proc. Natl. Acad. Sci. U.S.A. 2012 109(35) E2306-15 
[ PubMed ID = 22869721 ] [ RRC reference ]

Nakagawa A, Sullivan KD, Xue D.
Caspase-activated phosphoinositide binding by CNT-1 promotes apoptosis by inhibiting the AKT pathway.
Nat. Struct. Mol. Biol. 2014 21(12) 1082-90 
[ PubMed ID = 25383666 ] [ RRC reference ]