Mutants (Isolated)

tm2309

Allele Nametm2309
Sequence NameF32A5.5
CGC Nameaqp-1
Worm BaseAllele Name tm2309
CGC Name aqp-1
Sequence F32A5.5
Phenotypehomozygous viable. Dr. C. Kenyon: short lived.
Mutation site14755/14756-15055/15056 (300 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(14114..14294, 14342..14672, 14718..14855, 14929..15055, 15107..15223, 16498..16518))
Map position0.5
Balancer
Map position of balancer
Sequence of primersIntFwd:GGCTTCTTCGATGTCAGGAT,ExtFwd:GGTTGACAGTGGATCCTCAT,IntRev:CCGAGGAAGATACTTTGCCT,ExtRev:GCAGTCTGCACCCTATCAAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Anyanful A, Easley KA, Benian GM, Kalman D.
Conditioning protects C. elegans from lethal effects of enteropathogenic E. coli by activating genes that regulate lifespan and innate immunity.
Cell Host Microbe 2009 5(5) 450-62 
[ PubMed ID = 19454349 ] [ RRC reference ]