Home > Mutants (Isolated) > tm2303

Mutants (Isolated)

Allele Name		tm2303
Allele Type		Balanced
Sequence Name		T07G12.11
Gene Name		zim-3
Worm Base	Allele Name	tm2303
	Gene Name	zim-3
	Sequence	T07G12.11
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile. Dr. A. Dernburg: Dr. A. Dernburg: Dev. Cell 11, 817 (2006). Dr. W. Hanna-Rose: Genetics 177, 1221 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		30975/30976-31346/31347 (371 bp deletion)
Chromosome		IV
Putative gene structure		join(30289..30387, 30451..31172, 31330..31591, 31678..31929, 32010..32203, 32252..32313, 32359..32495)
Map position		4.63
Balancer		nT1 [qIs51]
Map position of balancer
Sequence of primers		IntFwd:TCAGATGACCTGCGATGACT,ExtFwd:GTCGATACGCCTGAGAACAT,IntRev:GAACTCCTGGGCTCAGTGCA,ExtRev:ATCCTACCTCAGTTGACAGT
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Liu Y, Zhao Q, Nie H, Zhang F, Fu T, Zhang Z, Qi F, Wang R, Zhou J, Gao J. SYP-5 regulates meiotic thermotolerance in Caenorhabditis elegans. J Mol Cell Biol 2021 13(9) 662-675  [ PubMed ID = 34081106 ] [ RRC reference ] Sun H, Nelms BL, Sleiman SF, Chamberlin HM, Hanna-Rose W. Modulation of Caenorhabditis elegans transcription factor activity by HIM-8 and the related Zinc-Finger ZIM proteins. Genetics 2007 177(2) 1221-6  [ PubMed ID = 17720937 ] [ RRC reference ] Phillips CM, Dernburg AF. A family of zinc-finger proteins is required for chromosome-specific pairing and synapsis during meiosis in C. elegans. Dev Cell 2006 11(6) 817-29  [ PubMed ID = 17141157 ] [ RRC reference ]