Mutants (Isolated)

tm2303

Allele Nametm2303
BalanceCompleted
OutCrossNot Accepted
Sequence NameT07G12.11
Gene Namezim-3
Worm BaseAllele Name tm2303 (x1)
Gene Name zim-3
Sequence T07G12.11
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. A. Dernburg: Dr. A. Dernburg: Dev. Cell 11, 817 (2006). Dr. W. Hanna-Rose: Genetics 177, 1221 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 30975/30976-31346/31347 (371 bp deletion)
ChromosomeIV
Putative gene structurejoin(30289..30387, 30451..31172, 31330..31591, 31678..31929, 32010..32203, 32252..32313, 32359..32495)
Map position4.63
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersIntFwd:TCAGATGACCTGCGATGACT,ExtFwd:GTCGATACGCCTGAGAACAT,IntRev:GAACTCCTGGGCTCAGTGCA,ExtRev:ATCCTACCTCAGTTGACAGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538 
[ PubMed ID = 38917330 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910 
[ PubMed ID = 38783998 ] [ RRC reference ]

Liu Y, Zhao Q, Nie H, Zhang F, Fu T, Zhang Z, Qi F, Wang R, Zhou J, Gao J.
SYP-5 regulates meiotic thermotolerance in Caenorhabditis elegans.
J Mol Cell Biol 2021 13(9) 662-675 
[ PubMed ID = 34081106 ] [ RRC reference ]

Sun H, Nelms BL, Sleiman SF, Chamberlin HM, Hanna-Rose W.
Modulation of Caenorhabditis elegans transcription factor activity by HIM-8 and the related Zinc-Finger ZIM proteins.
Genetics 2007 177(2) 1221-6 
[ PubMed ID = 17720937 ] [ RRC reference ]

Phillips CM, Dernburg AF.
A family of zinc-finger proteins is required for chromosome-specific pairing and synapsis during meiosis in C. elegans.
Dev Cell 2006 11(6) 817-29 
[ PubMed ID = 17141157 ] [ RRC reference ]