Mutants (Isolated)

tm2303

Allele Nametm2303
Sequence NameT07G12.11
CGC Namezim-3
Worm BaseAllele Name tm2303
CGC Name zim-3
Sequence T07G12.11
Phenotypelethal or sterile. Dr. A. Dernburg: Dr. A. Dernburg: Dev. Cell 11, 817 (2006). Dr. W. Hanna-Rose: Genetics 177, 1221 (2007).
Mutation site30975/30976-31346/31347 (371 bp deletion)
ChromosomeIV
Putative gene structurejoin(30289..30387, 30451..31172, 31330..31591, 31678..31929, 32010..32203, 32252..32313, 32359..32495)
Map position4.63
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersIntFwd:TCAGATGACCTGCGATGACT,ExtFwd:GTCGATACGCCTGAGAACAT,IntRev:GAACTCCTGGGCTCAGTGCA,ExtRev:ATCCTACCTCAGTTGACAGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Sun H, Nelms BL, Sleiman SF, Chamberlin HM, Hanna-Rose W.
Modulation of Caenorhabditis elegans transcription factor activity by HIM-8 and the related Zinc-Finger ZIM proteins.
Genetics 2007 177(2) 1221-6 
[ PubMed ID = 17720937 ] [ RRC reference ]

Phillips CM, Dernburg AF.
A family of zinc-finger proteins is required for chromosome-specific pairing and synapsis during meiosis in C. elegans.
Dev. Cell 2006 11(6) 817-29 
[ PubMed ID = 17141157 ] [ RRC reference ]