Mutants (Isolated)

tm2302

Allele Nametm2302
Sequence NameY87G2A.4
CGC Nameaex-6
Worm BaseAllele Name tm2302
CGC Name aex-6
Sequence Y87G2A.4
Phenotypehomozygous viable.
Mutation site53122/53123-53361/53362 (239 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(52605..52669, 52945..53069, 53125..53237, 53373..53487, 54124..54281, 54330..54401))
Map position21.43
Balancer
Map position of balancer
Sequence of primersIntRev:CAACAGCGTTCTTCCGAGAT,ExtFwd:AACGGAAGAGACGACGTCTC,IntFwd:GACGACGTCTCAACAGATTG,ExtRev:GTGAGGCTAATTCTTCACTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mills H, Ortega A, Law W, Hapiak V, Summers P, Clark T, Komuniecki R.
Opiates Modulate Noxious Chemical Nociception through a Complex Monoaminergic/Peptidergic Cascade.
J. Neurosci. 2016 36(20) 5498-508 
[ PubMed ID = 27194330 ] [ RRC reference ]

Harris G, Mills H, Wragg R, Hapiak V, Castelletto M, Korchnak A, Komuniecki RW.
The monoaminergic modulation of sensory-mediated aversive responses in Caenorhabditis elegans requires glutamatergic/peptidergic cotransmission.
J. Neurosci. 2010 30(23) 7889-99 
[ PubMed ID = 20534837 ] [ RRC reference ]