Mutants (Isolated)

tm2285

Allele Nametm2285
Sequence NameF35H10.6
CGC NameF35H10.6
Worm BaseAllele Name tm2285
CGC Name F35H10.6
Sequence F35H10.6
Phenotypelethal or sterile
Mutation site4108/4109-AAATTATTTTTATAATATTTTTATAAAA-4580/4581 (472 bp deletion + 28 bp insertion)
ChromosomeIV
Putative gene structurejoin(4024..4075, 4140..4203, 4252..4357, 4400..4467, 4512..4755)
Map position3.71
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersExtRev:CGTAGGGAAATGTGGATGAG,IntRev:CACATATGGCATATCCATCG,ExtFwd:CTACATTCCGCCGTCCTGAT,IntFwd:GTTGCCGAGTAGCCAAGGAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mishur RJ, Khan M, Munk√°csy E, Sharma L, Bokov A, Beam H, Radetskaya O, Borror M, Lane R, Bai Y, Rea SL.
Mitochondrial metabolites extend lifespan.
Aging Cell 2016 15(2) 336-48 
[ PubMed ID = 26729005 ] [ RRC reference ]

Butler JA, Mishur RJ, Bhaskaran S, Rea SL.
A metabolic signature for long life in the Caenorhabditis elegans Mit mutants.
Aging Cell 2013 12(1) 130-8 
[ PubMed ID = 23173729 ] [ RRC reference ]