Home > Mutants (Isolated) > tm2282

Mutants (Isolated)

Allele Name		tm2282
Allele Type		Normal
Sequence Name		F20D1.2
Gene Name		tbc-1
Worm Base	Allele Name	tm2282
	Gene Name	tbc-1
	Sequence	F20D1.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. Y. Jin: no specific neuronal phenotype is found.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		5563/5564-6079/6080 (516 bp deletion)
Chromosome		X
Putative gene structure		join(5068..5123, 5174..5249, 5306..5515, 5581..5738, 6000..6123, 6169..6254, 6301..6532, 6735..6836, 6885..7080, 7132..7235, 7539..7772, 8447..8712, 8759..8840)
Map position		21.61
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GGCCGGAATAACGGACTCTC,IntFwd:CGGGACCAACCAATAATACA,ExtRev:CCGATACAATCGTGAAGCTC,IntRev:CTCTTATAGCCTCCCTGAAC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV. The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction. bioRxiv 2023    [ PubMed ID = 38045350 ] [ RRC reference ] Hannemann M, Sasidharan N, Hegermann J, Kutscher LM, Koenig S, Eimer S. TBC-8, a putative RAB-2 GAP, regulates dense core vesicle maturation in Caenorhabditis elegans. PLoS Genet 2012 8(5) e1002722  [ PubMed ID = 22654674 ] [ RRC reference ] Alper S, Laws R, Lackford B, Boyd WA, Dunlap P, Freedman JH, Schwartz DA. Identification of innate immunity genes and pathways using a comparative genomics approach. Proc Natl Acad Sci U S A 2008 105(19) 7016-21  [ PubMed ID = 18463287 ] [ RRC reference ]