Mutants (Isolated)

tm2272

Allele Nametm2272
Sequence NameY53H1C.2
CGC Nameego-2
Worm BaseAllele Name tm2272
CGC Name ego-2
Sequence Y53H1C.2
Phenotypelethal or sterile
Mutation site32560/32561-33186/33187 (626 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(17718..17771, 29678..29833, 30294..30434, 31602..31743, 32687..32814, 32872..32946, 33001..33105))
Map position7.97
BalancerhT2
Map position of balancer
Sequence of primersExtFwd:CCGCGTTTTCAGTGGTAAGA,ExtRev:GCGCGCATGCACTGCTAAAA,IntFwd:CCTTGTCTGCTCGGCAGCAT,IntRev:TGTCAGCCAAAAACCCCGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Liu Y, Maine EM.
The Bro1-domain protein, EGO-2, promotes Notch signaling in Caenorhabditis elegans.
Genetics 2007 176(4) 2265-77 
[ PubMed ID = 17603118 ] [ RRC reference ]