Mutants (Isolated)

tm2266

Allele Nametm2266
Sequence NameF55A4.5
CGC Namestau-1
Worm BaseAllele Name tm2266
CGC Name stau-1
Sequence F55A4.5
Phenotypehomozygous viable
Mutation site26567/26568-26950/26951 (383 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(23975..24073, 24216..24349, 24428..24613, 24859..24992, 25207..25672, 26343..26745, 26793..27010, 29885..29992, 30040..30154, 30205..30342, 30908..31024))
Map position-18.82
Balancer
Map position of balancer
Sequence of primersExtRev:GTAAAATCCTCTCGAGCCCT,IntRev:CCAGATACCACCAAACCCCA,ExtFwd:GCGTTGCAGAGACTGGCAGT,IntFwd:CACTAAGATGCTCCACCGTA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Ren Z, Veksler-Lublinsky I, Morrissey D, Ambros V.
Staufen Negatively Modulates MicroRNA Activity in Caenorhabditis elegans.
G3 (Bethesda) 2016 6(5) 1227-37 
[ PubMed ID = 26921297 ] [ RRC reference ]

Nishijima S, Maruyama IN.
Appetitive Olfactory Learning and Long-Term Associative Memory in Caenorhabditis elegans.
Front Behav Neurosci 2017 11 80 
[ PubMed ID = 28507513 ] [ RRC reference ]

LeGendre JB, Campbell ZT, Kroll-Conner P, Anderson P, Kimble J, Wickens M.
RNA targets and specificity of Staufen, a double-stranded RNA-binding protein in Caenorhabditis elegans.
J Biol Chem 2013 288(4) 2532-45 
[ PubMed ID = 23195953 ] [ RRC reference ]

Antonacci S, Forand D, Wolf M, Tyus C, Barney J, Kellogg L, Simon MA, Kerr G, Wells KL, Younes S, Mortimer NT, Olesnicky EC, Killian DJ.
Conserved RNA-binding proteins required for dendrite morphogenesis in Caenorhabditis elegans sensory neurons.
G3 (Bethesda) 2015 5(4) 639-53 
[ PubMed ID = 25673135 ] [ RRC reference ]

Amano H, Maruyama IN.
Aversive olfactory learning and associative long-term memory in Caenorhabditis elegans.
Learn Mem 2011 18(10) 654-65 
[ PubMed ID = 21960709 ] [ RRC reference ]

Nix P, Hammarlund M, Hauth L, Lachnit M, Jorgensen EM, Bastiani M.
Axon regeneration genes identified by RNAi screening in C. elegans.
J Neurosci 2014 34(2) 629-45 
[ PubMed ID = 24403161 ] [ RRC reference ]