Mutants (Isolated)

tm2266

Allele Nametm2266
Sequence NameF55A4.5
CGC Namestau-1
Worm BaseAllele Name tm2266
CGC Name stau-1
Sequence F55A4.5
Phenotypehomozygous viable
Mutation site26567/26568-26950/26951 (383 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(23975..24073, 24216..24349, 24428..24613, 24859..24992, 25207..25672, 26343..26745, 26793..27010, 29885..29992, 30040..30154, 30205..30342, 30908..31024))
Map position-18.82
Balancer
Map position of balancer
Sequence of primersExtRev:GTAAAATCCTCTCGAGCCCT,IntRev:CCAGATACCACCAAACCCCA,ExtFwd:GCGTTGCAGAGACTGGCAGT,IntFwd:CACTAAGATGCTCCACCGTA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Antonacci S, Forand D, Wolf M, Tyus C, Barney J, Kellogg L, Simon MA, Kerr G, Wells KL, Younes S, Mortimer NT, Olesnicky EC, Killian DJ.
Conserved RNA-binding proteins required for dendrite morphogenesis in Caenorhabditis elegans sensory neurons.
G3 (Bethesda) 2015 5(4) 639-53 
[ PubMed ID = 25673135 ] [ RRC reference ]

LeGendre JB, Campbell ZT, Kroll-Conner P, Anderson P, Kimble J, Wickens M.
RNA targets and specificity of Staufen, a double-stranded RNA-binding protein in Caenorhabditis elegans.
J. Biol. Chem. 2013 288(4) 2532-45 
[ PubMed ID = 23195953 ] [ RRC reference ]

Ren Z, Veksler-Lublinsky I, Morrissey D, Ambros V.
Staufen Negatively Modulates MicroRNA Activity in Caenorhabditis elegans.
G3 (Bethesda) 2016 6(5) 1227-37 
[ PubMed ID = 26921297 ] [ RRC reference ]

Nishijima S, Maruyama IN.
Appetitive Olfactory Learning and Long-Term Associative Memory in Caenorhabditis elegans.
Front Behav Neurosci 2017 11 80 
[ PubMed ID = 28507513 ] [ RRC reference ]

Amano H, Maruyama IN.
Aversive olfactory learning and associative long-term memory in Caenorhabditis elegans.
Learn. Mem. 2011 18(10) 654-65 
[ PubMed ID = 21960709 ] [ RRC reference ]

Nix P, Hammarlund M, Hauth L, Lachnit M, Jorgensen EM, Bastiani M.
Axon regeneration genes identified by RNAi screening in C. elegans.
J. Neurosci. 2014 34(2) 629-45 
[ PubMed ID = 24403161 ] [ RRC reference ]