Mutants (Isolated)

tm2262

Allele Nametm2262
Sequence NameK04D7.1
CGC Namerack-1
Worm BaseAllele Name tm2262
CGC Name rack-1
Sequence K04D7.1
PhenotypeLet or Ste. Dr. E. Lundquist: slow-growing, semi-sterile. Dr. H.C. Korswagen: no QL migration defect or ALM/PLM polarity defects in the F1. Dr. Y. Jin: unable to homozygous the mutants.
Mutation site8118/8119-8449/8450 (331 bp deletion)
ChromosomeIV
Putative gene structurejoin(7951..8065, 8114..8297, 8341..8488, 8541..9071)
Map position4.56
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersIntRev:GTACAAGTGCTTGCCCTCGT,ExtFwd:AGCTTACCGGAACCCTCGAG,ExtRev:GTCGTTTCCTGGAAGGGTGT,IntFwd:GGGTCACACCGGATGGGTTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Demarco RS, Lundquist EA.
RACK-1 acts with Rac GTPase signaling and UNC-115/abLIM in Caenorhabditis elegans axon pathfinding and cell migration.
PLoS Genet 2010 6(11) e1001215 
[ PubMed ID = 21124943 ] [ RRC reference ]

Huang H, Zhu Y, Eliot MN, Knopik VS, McGeary JE, Carskadon MA, Hart AC.
Combining Human Epigenetics and Sleep Studies in Caenorhabditis elegans: A Cross-Species Approach for Finding Conserved Genes Regulating Sleep.
Sleep 2017 40(6)  
[ PubMed ID = 28431118 ] [ RRC reference ]