Mutants (Isolated)

tm2260

Allele Nametm2260
Sequence NameY47H9C.6
CGC Namecsp-3
Worm BaseAllele Name tm2260
CGC Name csp-3
Sequence Y47H9C.6
Phenotypehomozygous viable
Mutation site57898/57899-58091/58092 (193 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(58017..58073, 58116..58352, 58397..58522))
Map position12.87
Balancer
Map position of balancer
Sequence of primersExtFwd:GCTAGCATGACATCGTCACA,IntFwd:ATTCATCGTAGCAGCGGGAA,ExtRev:CGCCTCAAACGCCACTGGAT,IntRev:CGCCACTGGATTCTCTGGTA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Geng X, Shi Y, Nakagawa A, Yoshina S, Mitani S, Shi Y, Xue D.
Inhibition of CED-3 zymogen activation and apoptosis in Caenorhabditis elegans by caspase homolog CSP-3.
Nat. Struct. Mol. Biol. 2008 15(10) 1094-101 
[ PubMed ID = 18776901 ] [ RRC reference ]

Geng X, Zhou QH, Kage-Nakadai E, Shi Y, Yan N, Mitani S, Xue D.
Caenorhabditis elegans caspase homolog CSP-2 inhibits CED-3 autoactivation and apoptosis in germ cells.
Cell Death Differ. 2009 16(10) 1385-94 
[ PubMed ID = 19575016 ] [ RRC reference ]