Mutants (Isolated)

tm2256

Allele Nametm2256
Sequence NameT05D4.4
CGC Nameosm-7
Worm BaseAllele Name tm2256
CGC Name osm-7
Sequence T05D4.4
Phenotypehomozygous viable. Dr. A. Hart: Plos Biol. 6, e196 (2008).
Mutation site23507/23508-TC-23638/23639 (131 bp deletion + 2 bp insertion)
ChromosomeIII
Putative gene structurejoin(22064..22334, 22883..23055, 23269..23440, 23559..23698, 23854..23942, 24048..24159, 24220..24270, 24321..24533, 24867..25033, 25393..25500, 25546..25648, 26043..26538)
Map position21.27
Balancer
Map position of balancer
Sequence of primersExtFwd:CTCCTGGCCAACTGACCCAT,ExtRev:CGAGAGGCCACACTTACGCA,IntFwd:ACAGTAGCTAGTAGGCCTCT,IntRev:GGAAGCATAATGGTAGCGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Komatsu H, Chao MY, Larkins-Ford J, Corkins ME, Somers GA, Tucey T, Dionne HM, White JQ, Wani K, Boxem M, Hart AC.
OSM-11 facilitates LIN-12 Notch signaling during Caenorhabditis elegans vulval development.
PLoS Biol. 2008 6(8) e196 
[ PubMed ID = 18700817 ] [ RRC reference ]

Bennett HL, Khoruzhik Y, Hayden D, Huang H, Sanders J, Walsh MB, Biron D, Hart AC.
Normal sleep bouts are not essential for C. elegans survival and FoxO is important for compensatory changes in sleep.
BMC Neurosci 2018 19(1) 10 
[ PubMed ID = 29523076 ] [ RRC reference ]

Dresen A, Finkbeiner S, Dottermusch M, Beume JS, Li Y, Walz G, Neumann-Haefelin E.
Caenorhabditis elegans OSM-11 signaling regulates SKN-1/Nrf during embryonic development and adult longevity and stress response.
Dev. Biol. 2015 400(1) 118-31 
[ PubMed ID = 25637691 ] [ RRC reference ]

Singh K, Chao MY, Somers GA, Komatsu H, Corkins ME, Larkins-Ford J, Tucey T, Dionne HM, Walsh MB, Beaumont EK, Hart DP, Lockery SR, Hart AC.
C. elegans Notch signaling regulates adult chemosensory response and larval molting quiescence.
Curr. Biol. 2011 21(10) 825-34 
[ PubMed ID = 21549604 ] [ RRC reference ]

SorkaƧ A, DiIorio MA, O'Hern PJ, Baskoylu SN, Graham HK, Hart AC.
LIN-12/Notch Regulates GABA Signaling at the Caenorhabditis elegans Neuromuscular Junction.
G3 (Bethesda) 2018 8(8) 2825-2832 
[ PubMed ID = 29950427 ] [ RRC reference ]