Mutants (Isolated)

tm2255

Allele Nametm2255
Allele TypeNormal
Sequence NameF28B4.2
Gene Namergl-1
Worm BaseAllele Name tm2255
Gene Name rgl-1
Sequence F28B4.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 9175/9176-TNCTNAAAAAGGTT-9692/9693 (517 bp deletion + 14 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(6795..6915, 6959..7152, 7204..7440, 8108..8555, 8614..9144, 9207..9517, 9567..9906, 10749..10817, 10877..10977, 11033..11158, 16006..16110))
Map position-10.75
Balancer
Map position of balancer
Sequence of primersExtRev:CCGTCGAACGGCTTGTGGTA,IntFwd:CCATCTTCGTCCGTCTCATA,ExtFwd:GGTACCCTCCTGTTCTAGAA,IntRev:ATGTCTGGTTGGCAGCGATG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Shin H, Braendle C, Monahan KB, Kaplan REW, Zand TP, Mote FS, Peters EC, Reiner DJ.
Developmental fidelity is imposed by genetically separable RalGEF activities that mediate opposing signals.
PLoS Genet 2019 15(5) e1008056 
[ PubMed ID = 31086367 ] [ RRC reference ]