Mutants (Isolated)

tm2253

Allele Nametm2253
Sequence NameT08G5.5
CGC Namevps-39
Worm BaseAllele Name tm2253
CGC Name vps-39
Sequence T08G5.5
Phenotypelethal or sterile. Dr. C. Yang: slightly Dpy, cell corpses degradation defects. Dr. H. Sawa: non Psa, lethal, defective in chromosome segregation. Dr. Z. Zhou: persistent cell corpses in adult gonad.
Mutation site19127/19128-CATT-20172/20173 (1045 bp deletion + 4 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(17925..18137, 18737..19320, 19377..19908, 19954..20243, 20288..20656, 20709..21001, 21046..21188, 21237..21445, 21496..21561, 21609..21681))
Map position6.08
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersIntFwd:ACCGCGTTAATTGCCGAGAA,ExtFwd:CTCGCTTGTCGTCCGGTAGT,IntRev:CGAGTACAAGTTCAGCGAAG,ExtRev:CGTCCGGCAAATGTATTAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Fritz JA, Behm CA.
CUTI-1: A novel tetraspan protein involved in C. elegans CUTicle formation and epithelial integrity.
PLoS ONE 2009 4(4) e5117 
[ PubMed ID = 19357781 ] [ RRC reference ]

Manil-Ségalen M, Lefebvre C, Jenzer C, Trichet M, Boulogne C, Satiat-Jeunemaitre B, Legouis R.
The C. elegans LC3 acts downstream of GABARAP to degrade autophagosomes by interacting with the HOPS subunit VPS39.
Dev. Cell 2014 28(1) 43-55 
[ PubMed ID = 24374177 ] [ RRC reference ]

Xiao H, Chen D, Fang Z, Xu J, Sun X, Song S, Liu J, Yang C.
Lysosome biogenesis mediated by vps-18 affects apoptotic cell degradation in Caenorhabditis elegans.
Mol. Biol. Cell 2009 20(1) 21-32 
[ PubMed ID = 18923146 ] [ RRC reference ]

Chen Y, Scarcelli V, Legouis R.
Approaches for Studying Autophagy in Caenorhabditis elegans.
Cells 2017 6(3)  
[ PubMed ID = 28867808 ] [ RRC reference ]

Delahaye JL, Foster OK, Vine A, Saxton DS, Curtin TP, Somhegyi H, Salesky R, Hermann GJ.
Caenorhabditis elegans HOPS and CCZ-1 mediate trafficking to lysosome-related organelles independently of RAB-7 and SAND-1.
Mol. Biol. Cell 2014 25(7) 1073-96 
[ PubMed ID = 24501423 ] [ RRC reference ]

Palmisano NJ, Meléndez A.
Autophagy in C. elegans development.
Dev. Biol. 2019 447(1) 103-125 
[ PubMed ID = 29709599 ] [ RRC reference ]