Mutants (Isolated)

tm2252

Allele Nametm2252
Sequence NameZC477.5
CGC Namerde-8
Worm BaseAllele Name tm2252
CGC Name rde-8
Sequence ZC477.5
Phenotypehomozygous viable. Rde against gon-1 (RNAi).
Mutation site16461/16462-GGTAGAGGTTATGGTGG-17665/17666 (1204 bp deletion + 17 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(16318..16438, 16971..17053, 17098..17195, 17243..17671, 17720..17825, 17878..17977, 18024..18106))
Map position3.29
Balancer
Map position of balancer
Sequence of primersIntFwd:GGTTGTTGTGTAGAGTGGTC,ExtFwd:CTCAGGTGGCTGTGGTTGTT,IntRev:GATGAATGCGCCAGCAGTGT,ExtRev:CAGATGGACGTACTCACATC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Tsai HY, Chen CC, Conte D Jr, Moresco JJ, Chaves DA, Mitani S, Yates JR 3rd, Tsai MD, Mello CC.
A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi.
Cell 2015 160(3) 407-19 
[ PubMed ID = 25635455 ] [ RRC reference ]

Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y.
A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans.
Neuron 2018 97(3) 511-519.e6 
[ PubMed ID = 29395906 ] [ RRC reference ]