Mutants (Isolated)

tm2244

Allele Nametm2244
Allele TypeBalanced
Sequence NameK03E5.3
Gene NameK03E5.3
Worm BaseAllele Name tm2244
Gene Name K03E5.3
Sequence K03E5.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. H. Sawa: Psa and extra DTC.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 11171/11172-11405/11406 (234 bp deletion)
ChromosomeI
Putative gene structurejoin(9122..9198, 11101..11135, 11212..11439, 12485..12722, 14103..14169, 14235..14393, 15804..16061, 16115..16159)
Map position-3.75
BalancerhT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primersIntFwd:GCCCTTTTGTCTAACCTGCT,ExtFwd:AGACCGTCTCATTTGCCCTT,ExtRev:ACCGCTTGGCAAATCGGTCA,IntRev:GCCTCACTTGCGTAGATAAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
de la Cova CC, Townley R, Greenwald I.
Negative feedback by conserved kinases patterns the degradation of Caenorhabditiselegans Raf in vulval fate patterning.
Development 2020 147(24)  
[ PubMed ID = 33144396 ] [ RRC reference ]