Mutants (Isolated)

tm2243

Allele Nametm2243
Sequence NameF14F4.1
CGC Namentr-2
Worm BaseAllele Name tm2243
CGC Name ntr-2
Sequence F14F4.1
Phenotypehomozygous viable. Dr. C. Bargmann: viable, fertile, normal thermotaxis. Dr. P. Sengupta: normal dye filling.
Mutation site2875/2876-GTA-4015/4016 (1140 bp deletion + 3 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(2554..2687,2740..2901,2952..3047, 3095..3189, 3234..3318, 3403..3524, 3574..3701, 4982..5101, 6154..6228,6276..6455))
Map position21.57
Balancer
Map position of balancer
Sequence of primersExtFwd:GACCGGTTACTGAAAGCGGT,IntFwd:TGAAAGCGGTGTAAGCATGA,ExtRev:TACCTGCAATCGCGCTCCAT,IntRev:GTGACCCTGATTTCGGTCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Scott E, Hudson A, Feist E, Calahorro F, Dillon J, de Freitas R, Wand M, Schoofs L, O'Connor V, Holden-Dye L.
An oxytocin-dependent social interaction between larvae and adult C. elegans.
Sci Rep 2017 7(1) 10122 
[ PubMed ID = 28860630 ] [ RRC reference ]

Garrison JL, Macosko EZ, Bernstein S, Pokala N, Albrecht DR, Bargmann CI.
Oxytocin/vasopressin-related peptides have an ancient role in reproductive behavior.
Science 2012 338(6106) 540-3 
[ PubMed ID = 23112335 ] [ RRC reference ]

Mills H, Wragg R, Hapiak V, Castelletto M, Zahratka J, Harris G, Summers P, Korchnak A, Law W, Bamber B, Komuniecki R.
Monoamines and neuropeptides interact to inhibit aversive behaviour in Caenorhabditis elegans.
EMBO J. 2012 31(3) 667-78 
[ PubMed ID = 22124329 ] [ RRC reference ]

Harris G, Mills H, Wragg R, Hapiak V, Castelletto M, Korchnak A, Komuniecki RW.
The monoaminergic modulation of sensory-mediated aversive responses in Caenorhabditis elegans requires glutamatergic/peptidergic cotransmission.
J. Neurosci. 2010 30(23) 7889-99 
[ PubMed ID = 20534837 ] [ RRC reference ]

Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R.
Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans.
J. Neurosci. 2013 33(35) 14107-16 
[ PubMed ID = 23986246 ] [ RRC reference ]