Mutants (Isolated)

tm2241

Allele Nametm2241
Allele TypeNormal
Sequence NameZK1248.10
Gene Nametbc-2
Worm BaseAllele Name tm2241
Gene Name tbc-2
Sequence ZK1248.10
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. Y. Jin: no specific neuronal phenotype is found. Dr. H. Sawa: abnormally large gut granueles, not Psa.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 16926/16927-ATACTTGA-17156/17157 (230 bp deletion + 8 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(14565..14585, 14636..14778, 14830..15346, 15395..15861, 15913..16157, 16205..16588, 16638..16774, 16822..16962, 17007..17421, 17466..17644, 17828..17905))
Map position-0.9
Balancer
Map position of balancer
Sequence of primersExtFwd:CTAGTAGAAGAGCAGCTCTC,IntFwd:GCAGCTCTCAGCGAATCGAC,ExtRev:GGCGCAGCATTCACTTATGA,IntRev:GTAATTGCGCTGGAATGTAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Traa A, Shields H, AlOkda A, Rudich ZD, Ko B, Van Raamsdonk JM.
Endosomal trafficking protein TBC-2 is required for the longevity of long-lived mitochondrial mutants.
Front Aging 2023 4 1145198 
[ PubMed ID = 37261067 ] [ RRC reference ]

Traa A, Soo SK, AlOkda A, Ko B, Rocheleau CE, Van Raamsdonk JM.
Endosomal trafficking protein TBC-2 modulates stress resistance and lifespan through DAF-16-dependent and independent mechanisms.
Aging Cell 2023 22(3) e13762 
[ PubMed ID = 36794357 ] [ RRC reference ]

Meraş İ, Chotard L, Liontis T, Ratemi Z, Wiles B, Seo JH, Van Raamsdonk JM, Rocheleau CE.
The Rab GTPase activating protein TBC-2 regulates endosomal localization of DAF-16 FOXO and lifespan.
PLoS Genet 2022 18(8) e1010328 
[ PubMed ID = 35913999 ] [ RRC reference ]

Morris C, Foster OK, Handa S, Peloza K, Voss L, Somhegyi H, Jian Y, Vo MV, Harp M, Rambo FM, Yang C, Hermann GJ.
Function and regulation of the Caenorhabditis elegans Rab32 family member GLO-1 in lysosome-related organelle biogenesis.
PLoS Genet 2018 14(11) e1007772 
[ PubMed ID = 30419011 ] [ RRC reference ]

van der Vaart A, Rademakers S, Jansen G.
DLK-1/p38 MAP Kinase Signaling Controls Cilium Length by Regulating RAB-5 Mediated Endocytosis in Caenorhabditis elegans.
PLoS Genet 2015 11(12) e1005733 
[ PubMed ID = 26657059 ] [ RRC reference ]

Liu K, Jian Y, Sun X, Yang C, Gao Z, Zhang Z, Liu X, Li Y, Xu J, Jing Y, Mitani S, He S, Yang C.
Negative regulation of phosphatidylinositol 3-phosphate levels in early-to-late endosome conversion.
J Cell Biol 2016 212(2) 181-98 
[ PubMed ID = 26783301 ] [ RRC reference ]

Gengyo-Ando K, Kage-Nakadai E, Yoshina S, Otori M, Kagawa-Nagamura Y, Nakai J, Mitani S.
Distinct roles of the two VPS33 proteins in the endolysosomal system in Caenorhabditis elegans.
Traffic 2016 17(11) 1197-1213 
[ PubMed ID = 27558849 ] [ RRC reference ]

Law F, Seo JH, Wang Z, DeLeon JL, Bolis Y, Brown A, Zong WX, Du G, Rocheleau CE.
The VPS34 PI3K negatively regulates RAB-5 during endosome maturation.
J Cell Sci 2017 130(12) 2007-2017 
[ PubMed ID = 28455411 ] [ RRC reference ]

Sasidharan N, Sumakovic M, Hannemann M, Hegermann J, Liewald JF, Olendrowitz C, Koenig S, Grant BD, Rizzoli SO, Gottschalk A, Eimer S.
RAB-5 and RAB-10 cooperate to regulate neuropeptide release in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2012 109(46) 18944-9 
[ PubMed ID = 23100538 ] [ RRC reference ]

Lorenowicz MJ, Macurkova M, Harterink M, Middelkoop TC, de Groot R, Betist MC, Korswagen HC.
Inhibition of late endosomal maturation restores Wnt secretion in Caenorhabditis elegans vps-29 retromer mutants.
Cell Signal 2014 26(1) 19-31 
[ PubMed ID = 24056045 ] [ RRC reference ]

Liu O, Grant BD.
Basolateral Endocytic Recycling Requires RAB-10 and AMPH-1 Mediated Recruitment of RAB-5 GAP TBC-2 to Endosomes.
PLoS Genet 2015 11(9) e1005514 
[ PubMed ID = 26393361 ] [ RRC reference ]

Sun L, Liu O, Desai J, Karbassi F, Sylvain MA, Shi A, Zhou Z, Rocheleau CE, Grant BD.
CED-10/Rac1 regulates endocytic recycling through the RAB-5 GAP TBC-2.
PLoS Genet 2012 8(7) e1002785 
[ PubMed ID = 22807685 ] [ RRC reference ]

Chotard L, Skorobogata O, Sylvain MA, Shrivastava S, Rocheleau CE.
TBC-2 is required for embryonic yolk protein storage and larval survival during L1 diapause in Caenorhabditis elegans.
PLoS One 2010 5(12) e15662 
[ PubMed ID = 21203392 ] [ RRC reference ]

Chotard L, Mishra AK, Sylvain MA, Tuck S, Lambright DG, Rocheleau CE.
TBC-2 regulates RAB-5/RAB-7-mediated endosomal trafficking in Caenorhabditis elegans.
Mol Biol Cell 2010 21(13) 2285-96 
[ PubMed ID = 20462958 ] [ RRC reference ]

Li W, Zou W, Zhao D, Yan J, Zhu Z, Lu J, Wang X.
C. elegans Rab GTPase activating protein TBC-2 promotes cell corpse degradation by regulating the small GTPase RAB-5.
Development 2009 136(14) 2445-55 
[ PubMed ID = 19542357 ] [ RRC reference ]