Mutants (Isolated)

tm2241

Allele Nametm2241
Sequence NameZK1248.10
CGC Nametbc-2
Worm BaseAllele Name tm2241
CGC Name tbc-2
Sequence ZK1248.10
Phenotypehomozygous viable. Dr. Y. Jin: no specific neuronal phenotype is found. Dr. H. Sawa: abnormally large gut granueles, not Psa.
Mutation site16926/16927-ATACTTGA-17156/17157 (230 bp deletion + 8 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(14565..14585, 14636..14778, 14830..15346, 15395..15861, 15913..16157, 16205..16588, 16638..16774, 16822..16962, 17007..17421, 17466..17644, 17828..17905))
Map position-0.9
Balancer
Map position of balancer
Sequence of primersExtFwd:CTAGTAGAAGAGCAGCTCTC,IntFwd:GCAGCTCTCAGCGAATCGAC,ExtRev:GGCGCAGCATTCACTTATGA,IntRev:GTAATTGCGCTGGAATGTAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chotard L, Mishra AK, Sylvain MA, Tuck S, Lambright DG, Rocheleau CE.
TBC-2 regulates RAB-5/RAB-7-mediated endosomal trafficking in Caenorhabditis elegans.
Mol. Biol. Cell 2010 21(13) 2285-96 
[ PubMed ID = 20462958 ] [ RRC reference ]

Chotard L, Skorobogata O, Sylvain MA, Shrivastava S, Rocheleau CE.
TBC-2 is required for embryonic yolk protein storage and larval survival during L1 diapause in Caenorhabditis elegans.
PLoS ONE 2010 5(12) e15662 
[ PubMed ID = 21203392 ] [ RRC reference ]

Sun L, Liu O, Desai J, Karbassi F, Sylvain MA, Shi A, Zhou Z, Rocheleau CE, Grant BD.
CED-10/Rac1 regulates endocytic recycling through the RAB-5 GAP TBC-2.
PLoS Genet. 2012 8(7) e1002785 
[ PubMed ID = 22807685 ] [ RRC reference ]

Law F, Seo JH, Wang Z, DeLeon JL, Bolis Y, Brown A, Zong WX, Du G, Rocheleau CE.
The VPS34 PI3K negatively regulates RAB-5 during endosome maturation.
J. Cell. Sci. 2017 130(12) 2007-2017 
[ PubMed ID = 28455411 ] [ RRC reference ]

Li W, Zou W, Zhao D, Yan J, Zhu Z, Lu J, Wang X.
C. elegans Rab GTPase activating protein TBC-2 promotes cell corpse degradation by regulating the small GTPase RAB-5.
Development 2009 136(14) 2445-55 
[ PubMed ID = 19542357 ] [ RRC reference ]

Liu O, Grant BD.
Basolateral Endocytic Recycling Requires RAB-10 and AMPH-1 Mediated Recruitment of RAB-5 GAP TBC-2 to Endosomes.
PLoS Genet. 2015 11(9) e1005514 
[ PubMed ID = 26393361 ] [ RRC reference ]

Gengyo-Ando K, Kage-Nakadai E, Yoshina S, Otori M, Kagawa-Nagamura Y, Nakai J, Mitani S.
Distinct roles of the two VPS33 proteins in the endolysosomal system in Caenorhabditis elegans.
Traffic 2016 17(11) 1197-1213 
[ PubMed ID = 27558849 ] [ RRC reference ]

Lorenowicz MJ, Macurkova M, Harterink M, Middelkoop TC, de Groot R, Betist MC, Korswagen HC.
Inhibition of late endosomal maturation restores Wnt secretion in Caenorhabditis elegans vps-29 retromer mutants.
Cell. Signal. 2014 26(1) 19-31 
[ PubMed ID = 24056045 ] [ RRC reference ]

Sasidharan N, Sumakovic M, Hannemann M, Hegermann J, Liewald JF, Olendrowitz C, Koenig S, Grant BD, Rizzoli SO, Gottschalk A, Eimer S.
RAB-5 and RAB-10 cooperate to regulate neuropeptide release in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2012 109(46) 18944-9 
[ PubMed ID = 23100538 ] [ RRC reference ]