Mutants (Isolated)

tm2223

Allele Nametm2223
Sequence NameY18D10A.5
CGC Namegsk-3
Worm BaseAllele Name tm2223
CGC Name gsk-3
Sequence Y18D10A.5
Phenotypelethal or sterile. Dr. J. Kimble: most homozygotes are larval lethal with some sterile escapers. A low penetrance embryonic lethality has not been excluded. Dr. H. Sawa: not Psa.
Mutation site41421/41422-41811/41812 (390 bp deletion)
ChromosomeI
Putative gene structurejoin(39072..39164, 40245..40513, 41360..41936, 44226..44375)
Map position14.09
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersIntRev:CGTCGGCGTATACTCGATAA,IntFwd:GCCCGGCACTATTCGAAGCA,ExtRev:CCGAGACGTCGGCGTATACT,ExtFwd:TGCAGAGTTGCCCGGCACTA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Tanizawa Y, Kuhara A, Inada H, Kodama E, Mizuno T, Mori I.
Inositol monophosphatase regulates localization of synaptic components and behavior in the mature nervous system of C. elegans.
Genes Dev. 2006 20(23) 3296-310 
[ PubMed ID = 17158747 ] [ RRC reference ]

Furuta T, Joo HJ, Trimmer KA, Chen SY, Arur S.
GSK-3 promotes S-phase entry and progression in C. elegans germline stem cells to maintain tissue output.
Development 2018 145(10)  
[ PubMed ID = 29695611 ] [ RRC reference ]