Mutants (Isolated)

tm2218

Allele Nametm2218
Sequence NameB0024.14
CGC Namecrm-1
Worm BaseAllele Name tm2218
CGC Name crm-1
Sequence B0024.14
Phenotypehomozygous viable. Dr. P. Bazzicalupo: normal egg laying and fertility. Dr. A. Frand: molting defective.
Mutation site38329/38330-T-38521/38522 (192 bp deletion +1 bp insertion)
ChromosomeV
Putative gene structurejoin(complement(AL021478.1:559..628, 39737..39879, 39320..39431, 38531..38914, 38176..38461, 38017..38130, 37824..37969, 37689..37779, 37471..37640, 37079..37423, 36693..37010, 36457..36647, 36288..36409, 36150..36242, 36000..36099))
Map position2.49
Balancer
Map position of balancer
Sequence of primersExtFwd:AAGTCCATTGGCACATCTGT,IntFwd:CCTCAGAGAACACAGTTCGA,ExtRev:TGTGCACTGTCCTCCTATGT,IntRev:GTCCACCTGATAGTATCCGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Fung WY, Fat KF, Eng CK, Lau CK.
crm-1 facilitates BMP signaling to control body size in Caenorhabditis elegans.
Dev. Biol. 2007 311(1) 95-105 
[ PubMed ID = 17869238 ] [ RRC reference ]

Liu Z, Shi H, Szymczak LC, Aydin T, Yun S, Constas K, Schaeffer A, Ranjan S, Kubba S, Alam E, McMahon DE, He J, Shwartz N, Tian C, Plavskin Y, Lindy A, Dad NA, Sheth S, Amin NM, Zimmerman S, Liu D, Schwarz EM, Smith H, Krause MW, Liu J.
Promotion of bone morphogenetic protein signaling by tetraspanins and glycosphingolipids.
PLoS Genet. 2015 11(5) e1005221 
[ PubMed ID = 25978409 ] [ RRC reference ]