Allele Name | tm2218 |
Sequence Name | B0024.14 |
CGC Name | crm-1 |
Worm Base | Allele Name |
tm2218
|
CGC Name |
crm-1
|
Sequence |
B0024.14
|
Phenotype | homozygous viable. Dr. P. Bazzicalupo: normal egg laying and fertility. Dr. A. Frand: molting defective. |
Mutation site | 38329/38330-T-38521/38522 (192 bp deletion +1 bp insertion) |
Chromosome | V |
Putative gene structure | join(complement(AL021478.1:559..628, 39737..39879, 39320..39431, 38531..38914, 38176..38461, 38017..38130, 37824..37969, 37689..37779, 37471..37640, 37079..37423, 36693..37010, 36457..36647, 36288..36409, 36150..36242, 36000..36099)) |
Map position | 2.49 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:AAGTCCATTGGCACATCTGT,IntFwd:CCTCAGAGAACACAGTTCGA,ExtRev:TGTGCACTGTCCTCCTATGT,IntRev:GTCCACCTGATAGTATCCGT |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Liu Z, Shi H, Szymczak LC, Aydin T, Yun S, Constas K, Schaeffer A, Ranjan S, Kubba S, Alam E, McMahon DE, He J, Shwartz N, Tian C, Plavskin Y, Lindy A, Dad NA, Sheth S, Amin NM, Zimmerman S, Liu D, Schwarz EM, Smith H, Krause MW, Liu J. Promotion of bone morphogenetic protein signaling by tetraspanins and glycosphingolipids. PLoS Genet 2015 11(5) e1005221
[ PubMed ID = 25978409 ]
[ RRC reference ]
|
Fung WY, Fat KF, Eng CK, Lau CK. crm-1 facilitates BMP signaling to control body size in Caenorhabditis elegans. Dev Biol 2007 311(1) 95-105
[ PubMed ID = 17869238 ]
[ RRC reference ]
|
|