Mutants (Isolated)

tm2217

Allele Nametm2217
Sequence NameC08F8.8
CGC Namenhr-67
Worm BaseAllele Name tm2217
CGC Name nhr-67
Sequence C08F8.8
Phenotypelethal or sterile
Mutation site24339/24340-25423/25424 (1081 bp deletion)
ChromosomeIV
Putative gene structurejoin(21255..21291, 22582..22682, 23298..23395, 23493..23622, 24570..24839, 24890..25059, 25471..25746, 25795..25963)
Map position4.92
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtRev:ATGAAAATCCGGGCGAGGCA,ExtFwd:CACCTAGGATATAGAGCATG,IntFwd:GCCGGAAGTGCTGAGTATTC,IntRev:AGGGGATGATGCCGATGAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Verghese E, Schocken J, Jacob S, Wimer AM, Royce R, Nesmith JE, Baer GM, Clever S, McCain E, Lakowski B, Wightman B.
The tailless ortholog nhr-67 functions in the development of the C. elegans ventral uterus.
Dev. Biol. 2011 356(2) 516-28 
[ PubMed ID = 21718694 ] [ RRC reference ]

Matus DQ, Lohmer LL, Kelley LC, Schindler AJ, Kohrman AQ, Barkoulas M, Zhang W, Chi Q, Sherwood DR.
Invasive Cell Fate Requires G1 Cell-Cycle Arrest and Histone Deacetylase-Mediated Changes in Gene Expression.
Dev. Cell 2015 35(2) 162-74 
[ PubMed ID = 26506306 ] [ RRC reference ]