Mutants (Isolated)

tm2214

Allele Nametm2214
Sequence NameC44B7.3
CGC Nameaff-1
Worm BaseAllele Name tm2214
CGC Name aff-1
Sequence C44B7.3
Phenotypehomozygous viable.
Mutation site4362/4363-5356/5357 (994 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(2536..2697, 2744..2834, 2904..3105, 3556..3634, 3683..3903, 3952..4051, 4107..4240, 4286..4406, 4456..4608, 4690..4892, 4940..5093, 5350..5454))
Map position0.13
Balancer
Map position of balancer
Sequence of primersIntRev:CTCGCAATCAATTAGCAGCT,IntFwd:GTTCCTTTGACGCCCTGAAT,ExtRev:GCCGCTTTTCGATGCGTGAT,ExtFwd:CGCGATGAGCTTTCGATCGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hodgkin J.
Nematode Autotomy Requires Molting and Entails Tissue Healing without Obvious Regeneration.
J Dev Biol 2019 7(4)  
[ PubMed ID = 31771156 ] [ RRC reference ]

Soulavie F, Hall DH, Sundaram MV.
The AFF-1 exoplasmic fusogen is required for endocytic scission and seamless tube elongation.
Nat Commun 2018 9(1) 1741 
[ PubMed ID = 29717108 ] [ RRC reference ]

Raiders SA, Eastwood MD, Bacher M, Priess JR.
Binucleate germ cells in Caenorhabditis elegans are removed by physiological apoptosis.
PLoS Genet 2018 14(7) e1007417 
[ PubMed ID = 30024879 ] [ RRC reference ]

Ghose P, Rashid A, Insley P, Trivedi M, Shah P, Singhal A, Lu Y, Bao Z, Shaham S.
EFF-1 fusogen promotes phagosome sealing during cell process clearance in Caenorhabditis elegans.
Nat Cell Biol 2018 20(4) 393-399 
[ PubMed ID = 29556089 ] [ RRC reference ]

Oren-Suissa M, Gattegno T, Kravtsov V, Podbilewicz B.
Extrinsic Repair of Injured Dendrites as a Paradigm for Regeneration by Fusion in Caenorhabditis elegans.
Genetics 2017 206(1) 215-230 
[ PubMed ID = 28283540 ] [ RRC reference ]

Ghosh-Roy A, Wu Z, Goncharov A, Jin Y, Chisholm AD.
Calcium and cyclic AMP promote axonal regeneration in Caenorhabditis elegans and require DLK-1 kinase.
J Neurosci 2010 30(9) 3175-83 
[ PubMed ID = 20203177 ] [ RRC reference ]

Chiorazzi M, Rui L, Yang Y, Ceribelli M, Tishbi N, Maurer CW, Ranuncolo SM, Zhao H, Xu W, Chan WC, Jaffe ES, Gascoyne RD, Campo E, Rosenwald A, Ott G, Delabie J, Rimsza LM, Shaham S, Staudt LM.
Related F-box proteins control cell death in Caenorhabditis elegans and human lymphoma.
Proc Natl Acad Sci U S A 2013 110(10) 3943-8 
[ PubMed ID = 23431138 ] [ RRC reference ]

Rasmussen JP, Feldman JL, Reddy SS, Priess JR.
Cell interactions and patterned intercalations shape and link epithelial tubes in C. elegans.
PLoS Genet 2013 9(9) e1003772 
[ PubMed ID = 24039608 ] [ RRC reference ]

Stone CE, Hall DH, Sundaram MV.
Lipocalin signaling controls unicellular tube development in the Caenorhabditis elegans excretory system.
Dev Biol 2009 329(2) 201-11 
[ PubMed ID = 19269285 ] [ RRC reference ]

Rasmussen JP, English K, Tenlen JR, Priess JR.
Notch signaling and morphogenesis of single-cell tubes in the C. elegans digestive tract.
Dev Cell 2008 14(4) 559-69 
[ PubMed ID = 18410731 ] [ RRC reference ]

Sapir A, Choi J, Leikina E, Avinoam O, Valansi C, Chernomordik LV, Newman AP, Podbilewicz B.
AFF-1, a FOS-1-regulated fusogen, mediates fusion of the anchor cell in C. elegans.
Dev Cell 2007 12(5) 683-98 
[ PubMed ID = 17488621 ] [ RRC reference ]