Mutants (Isolated)

tm2206

Allele Nametm2206
Sequence NameF52H3.6
CGC NameF52H3.6
Worm BaseAllele Name tm2206
CGC Name F52H3.6
Sequence F52H3.6
Phenotypehomozygous viable. Dr. K. Ashrai: normal fat content observed by Nile-Red staining.
Mutation site18777/18778-19243/19244 (466 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(17870..18124, 18171..18458, 18506..18784, 18863..18990, 19044..19083))
Map position1.82
Balancer
Map position of balancer
Sequence of primersIntRev:ACAAGTGCATGAGGGCGAGT,IntFwd:GTTTGCGTAGACTGCCCAAT,ExtRev:GACACTCTGCACCTCTCGTT,ExtFwd:CTTAAGACCCGTTTGCGTAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Liang B, Ferguson K, Kadyk L, Watts JL.
The role of nuclear receptor NHR-64 in fat storage regulation in Caenorhabditis elegans.
PLoS ONE 2010 5(3) e9869 
[ PubMed ID = 20360843 ] [ RRC reference ]